Answer
(5')GCGCAATATTTTGAGAAATATTGCGC(3'); it contains a palindrome.
The individual strands can form hairpin structures;
The two strands can form a cruciform.
Work Step by Step
If One strand of a double-helical DNA has the sequence
(5')GCGCAATATTTCTCAAAATATTGCGC(3').the base sequence of the complementary strand is (5')GCGCAATATTTTGAGAAATATTGCGC(3').
Palindrome is a special type of sequence is contained in this DNA segment that reads the same backwards as forwards.
The individual strands can form hairpin structures and the two strands can form a cruciform.
